pce_rbcL_410

Marker Overview
Namepce_rbcL_410
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:pce_rbcL_410
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTCCTGCTTATGT TAAAACT
3' Flanking SequenceTCCAAGGCCCGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGCC CC
SpeciesPrunus cerasus
Publication[view all]
ContactStijn Vanderzande
CommentFrom chloroplast
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Sequence
>pce_rbcL_410 ID=pce_rbcL_410|Name=pce_rbcL_410|organism=Prunus cerasus|type=genetic_marker|length=130bp
TGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTC
CTGCTTATGTTAAAACTYTCCAAGGCCCGCCTCATGGGATCCAAGTTGAG
AGAGATAAATTGAACAAGTATGGCCGCCCC