pce_atpB-rbcL_175_2

Marker Overview
Namepce_atpB-rbcL_175_2
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:pce_atpB-rbcL_175_2
TypeSNP
SNP AllelesC/T
5' Flanking SequenceAAGTTGATCGATTAATTCAATAAGAAATGGGCTTTAGCGCTCGATTTCGTTGGTACCATC CAAC
3' Flanking SequenceGAATCCAATTCAATTGTTTACTTATTCAATTTCAGTGAATTGAAAAATCCAAACAAAACC CATTT
SpeciesPrunus cerasus
Publication[view all]
ContactStijn Vanderzande
CommentFrom chloroplast
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Sequence
>pce_atpB-rbcL_175_2 ID=pce_atpB-rbcL_175_2|Name=pce_atpB-rbcL_175_2|organism=Prunus cerasus|type=genetic_marker|length=130bp
AAGTTGATCGATTAATTCAATAAGAAATGGGCTTTAGCGCTCGATTTCGT
TGGTACCATCCAACYGAATCCAATTCAATTGTTTACTTATTCAATTTCAG
TGAATTGAAAAATCCAAACAAAACCCATTT