pav-pce_trnS-trnG_799_2

Marker Overview
Namepav-pce_trnS-trnG_799_2
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:pav-pce_trnS-trnG_799_2
TypeSNP
SNP AllelesA/G
5' Flanking SequenceGAACCTTTTGTCGAACAATAAAACAATAAAATTGGTCGTAATAAAAAGTCAGAGTTAAAA GAAAAG
3' Flanking SequenceTAGGATCATAAAATAATCATGAAAATTAGAGCGTTTACGTGTTGTATCAGAGAACTTAAT GAG
SpeciesPrunus sp.
Publication[view all]
ContactStijn Vanderzande
CommentFrom chloroplast; polymorphic in both P. avium and P. cerasus
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Sequence
>pav-pce_trnS-trnG_799_2 ID=pav-pce_trnS-trnG_799_2|Name=pav-pce_trnS-trnG_799_2|organism=Prunus sp.|type=genetic_marker|length=130bp
GAACCTTTTGTCGAACAATAAAACAATAAAATTGGTCGTAATAAAAAGTC
AGAGTTAAAAGAAAAGRTAGGATCATAAAATAATCATGAAAATTAGAGCG
TTTACGTGTTGTATCAGAGAACTTAATGAG