pav_matK_908

Marker Overview
Namepav_matK_908
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:pav_matK_908
TypeSNP
SNP AllelesG/A
5' Flanking SequenceAAATCAATTCTGGCTTCGAAGGATACCCCTCTTCTGATGAATAAGTGGAAATATTATCTT GTCAATTT
3' Flanking SequenceTGGCAATGTCATTCTTATGTGTGGTCTCAACCGGGAAGGATTTATATAAATAAATTATCC A
SpeciesPrunus avium
Publication[view all]
ContactStijn Vanderzande
CommentFrom chloroplast
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Sequence
>pav_matK_908 ID=pav_matK_908|Name=pav_matK_908|organism=Prunus avium|type=genetic_marker|length=130bp
AAATCAATTCTGGCTTCGAAGGATACCCCTCTTCTGATGAATAAGTGGAA
ATATTATCTTGTCAATTTRTGGCAATGTCATTCTTATGTGTGGTCTCAAC
CGGGAAGGATTTATATAAATAAATTATCCA