pav_ARCP511_112_2

Marker Overview
Namepav_ARCP511_112_2
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:pav_ARCP511_112_2
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTGACCAATTTGAAAGGTCGCTTGATGTAGTTGAAATAACTGAATTTTGGGTTGTTCGATC AAGTAAAGGAAATTCAATAATGGAATTCATAACTGTCTCAATCTTTGTTAT
3' Flanking SequenceTTTTTTTATTGTTTGATGACTATTCAAGAGCTAAGACCATTCCAATGCTCCTTTTCGCCA TGCATAAAC
SpeciesPrunus avium
Publication[view all]
ContactStijn Vanderzande
CommentFrom chloroplast
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Sequence
>pav_ARCP511_112_2 ID=pav_ARCP511_112_2|Name=pav_ARCP511_112_2|organism=Prunus avium|type=genetic_marker|length=181bp
TGACCAATTTGAAAGGTCGCTTGATGTAGTTGAAATAACTGAATTTTGGG
TTGTTCGATCAAGTAAAGGAAATTCAATAATGGAATTCATAACTGTCTCA
ATCTTTGTTATYTTTTTTTATTGTTTGATGACTATTCAAGAGCTAAGACC
ATTCCAATGCTCCTTTTCGCCATGCATAAAC