pce_rbcL_410_2

Marker Overview
Namepce_rbcL_410_2
dbSNP IDN/A
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTCCTGCTTATGT TAAAACT
3' Flanking SequenceTCCAAGGCCCGCCTCATGGGATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGCC CC
SpeciesPrunus cerasus
Publication[view all]
ContactStijn Vanderzande
CommentFrom chloroplast
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Sequence
>pce_rbcL_410_2 ID=pce_rbcL_410_2|Name=pce_rbcL_410_2|organism=Prunus cerasus|type=genetic_marker|length=130bp
TGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTC
CTGCTTATGTTAAAACTYTCCAAGGCCCGCCTCATGGGATCCAAGTTGAG
AGAGATAAATTGAACAAGTATGGCCGCCCC