pce_atpB-rbcL_376

Marker Overview
Namepce_atpB-rbcL_376
dbSNP IDN/A
TypeSNP
SNP AllelesT/G
5' Flanking SequenceTTCCATATTATCTATGGAATTCGAACCCTATTTACGATTTCTTTTTTCTATCTCATTGGT CCTTA
3' Flanking SequenceTTACGATATCAGCATATCGATTTACGCTTAGCCTATTATTTTTTTTATATCCTT
SpeciesPrunus cerasus
Publication[view all]
ContactStijn Vanderzande
CommentFrom chloroplast
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Sequence
>pce_atpB-rbcL_376 ID=pce_atpB-rbcL_376|Name=pce_atpB-rbcL_376|organism=Prunus cerasus|type=genetic_marker|length=120bp
TTCCATATTATCTATGGAATTCGAACCCTATTTACGATTTCTTTTTTCTA
TCTCATTGGTCCTTAKTTACGATATCAGCATATCGATTTACGCTTAGCCT
ATTATTTTTTTTATATCCTT