UDMdSSR_028, UDMdSSR_028 (genetic_marker) Malus x domestica

Marker Overview
NameUDMdSSR_028
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Primer 1UDMdSSR_028.forward primer: ACTCCCCTGAAGAACACAATCA
Primer 2UDMdSSR_028.reverse primer: TACTCCATCCATCCAGAAGCTC
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerUDMdSSR_028.forward primerMalus x domesticaprimer
reverse primerUDMdSSR_028.reverse primerMalus x domesticaprimer