UDMdSSR_025, UDMdSSR_025 (genetic_marker) Malus x domestica

Marker Overview
NameUDMdSSR_025
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Primer 1UDMdSSR_025.forward primer: AGAAGACTAAAATGCCTCTGCG
Primer 2UDMdSSR_025.reverse primer: TATTGCTAACGATGTGGAAACG
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerUDMdSSR_025.forward primerMalus x domesticaprimer
reverse primerUDMdSSR_025.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
UDMdSSR_025UDMdSSR_025Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-RGTxGD-F1-2015GD_12N/A54.33UDMdSSR_025View