UDMdSSR_017, UDMdSSR_017 (genetic_marker) Malus x domestica

Marker Overview
NameUDMdSSR_017
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Primer 1UDMdSSR_017.forward primer: GTACCTGAGAGAGAAAGCGAGC
Primer 2UDMdSSR_017.reverse primer: ACTCCAGAAAAGGAAACATCCA
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerUDMdSSR_017.forward primerMalus x domesticaprimer
reverse primerUDMdSSR_017.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
UDMdSSR_017UDMdSSR_017Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-RGTxGD-F1-2015GD_12N/A57.91UDMdSSR_017View