UDMdSSR_010, UDMdSSR_010 (genetic_marker) Malus x domestica

Marker Overview
NameUDMdSSR_010
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Primer 1UDMdSSR_010.forward primer: ACATACCAGCGAAGAGAGGCTA
Primer 2UDMdSSR_010.reverse primer: AAAAGAAAACCCTACAACCCGT
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerUDMdSSR_010.forward primerMalus x domesticaprimer
reverse primerUDMdSSR_010.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
UDMdSSR_010UDMdSSR_010Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-RGTxGD-F1-2015GD_12N/A62.3UDMdSSR_010View