UDMdSSR_003, UDMdSSR_003 (genetic_marker) Malus x domestica

Marker Overview
NameUDMdSSR_003
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Primer 1UDMdSSR_003.forward primer: TCGTAATGAGCTGGGATACACA
Primer 2UDMdSSR_003.reverse primer: GACCTTTTGTGGTCAGGGAGTA
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerUDMdSSR_003.forward primerMalus x domesticaprimer
reverse primerUDMdSSR_003.reverse primerMalus x domesticaprimer