Gol013, Gol013 (genetic_marker) Prunus armeniaca

Marker Overview
NameGol013
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
PCR Condition60.53; 61.08
Primer 1Gol013.Forward Primer: CGCTTCCTGCCAAAACTG
Primer 2Gol013.Reverse Primer: TGGGGTTCCAGCACTACTTG
Product Length273
Publication[view all]
ContactMaria Badenes
Contact
NameDetails
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerGol013.Forward PrimerPrunus armeniacaprimer
Reverse PrimerGol013.Reverse PrimerPrunus armeniacaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Gol013Gol013Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-LL-F2-Lito-2011LG1N/A34.6Gol013View
2Apricot-integrated-Goldrich-2011LG1N/A27.1Gol013View