Gol005, Gol005 (genetic_marker) Prunus armeniaca

Marker Overview
NameGol005
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
PCR Condition60.39; 59.61
Primer 1Gol005.Forward Primer: TGAGCTTGAGGGTCTTCCAC
Primer 2Gol005.Reverse Primer: CTGCCACGGCCTTTTTATAC
Product Length227
Publication[view all]
ContactMaria Badenes
Contact
NameDetails
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerGol005.Forward PrimerPrunus armeniacaprimer
Reverse PrimerGol005.Reverse PrimerPrunus armeniacaprimer