PGS1.21, PGS1.21 (genetic_marker) Prunus armeniaca

Marker Overview
NamePGS1.21
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
Repeat Motif(TC)26
Primer 1PGS1.21.Forward primer: ccctggtgttctgctctctc
Primer 2PGS1.21.Reverse primer: catccacaaatgggaagcat
Product Length205
Publication[view all]
ContactMaria Luisa Badenes
V. Decroocq
Commentnot broadly applicable for MAS and that marker-assisted breeding based on the sole PPVres locus is not sufficient to unambiguously select PPVresistant apricot cultivars
Contact
NameDetails
Maria Luisa Badenes
First name:Maria
Last name:Badenes
Title:Professor
Institution:Valencian Institure for Agricultural Research
Address:Apartado Oficial, 46113 Moncada, Valencia, Spain
Email:badenes_mlu@gva.es
V. Decroocq
First name:V.
Last name:Decrocq
Institution:INRA, Bordeaux
Address:Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:France
Email:decroocq@bordeaux.inra.fr
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerPGS1.21.Forward primerPrunus armeniacaprimer
Reverse primerPGS1.21.Reverse primerPrunus armeniacaprimer


This genetic_marker is adjacent to the following heritable_phenotypic_marker feature(s):

Feature NameUnique NameSpeciesType
resistance to plum pox virusresistance to plum pox virus-PPVresPrunus armeniacaheritable_phenotypic_marker


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGS1.21PGS1.21Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-LL-F2-Lito-2012LG1N/A2.5PGS1.21View
2Apricot-integrated-F1-Goldrich-2012LG1N/A4.6PGS1.21View
3Apricot-BC-F1-2016B1N/A31.5PGS1.21View
4Apricot-BC-F1-2016C1N/A28.6PGS1.21View
5Apricot-GC-F1-2016G1N/A12.2PGS1.21View
6Apricot-GC-F1-2016C1N/A16.5PGS1.21View
7Apricot-BC-F1-2016-PhenologyB1N/A64.3PGS1.21View
8Apricot-BC-F1-2016-PhenologyC1N/A34.1PGS1.21View
9Apricot-GC-F1-2016-PhenologyC1N/A16.2PGS1.21View
10Apricot-GC-F1-2016-PhenologyG1N/A15.6PGS1.21View