PGS1.09, PGS1.09 (genetic_marker) Prunus armeniaca

Marker Overview
NamePGS1.09
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
Repeat Motif(CT)61
Primer 1PGS1.09.Forward primer: gccgttaaatatgagggcaaa
Primer 2PGS1.09.Reverse primer: tttttaccacctcccccttg
Product Length229
Publication[view all]
ContactMaria Luisa Badenes
Contact
NameDetails
Maria Luisa Badenes
First name:Maria
Last name:Badenes
Title:Professor
Institution:Valencian Institure for Agricultural Research
Address:Apartado Oficial, 46113 Moncada, Valencia, Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerPGS1.09.Forward primerPrunus armeniacaprimer
Reverse primerPGS1.09.Reverse primerPrunus armeniacaprimer