PGS1.03, PGS1.03 (genetic_marker) Prunus armeniaca

Marker Overview
NamePGS1.03
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
Repeat Motif(AG)22
Primer 1PGS1.03.Forward primer: gctctctccctgccattttt
Primer 2PGS1.03.Reverse primer: ccatcctccacttctcaacc
Product Length212
Publication[view all]
ContactMaria Luisa Badenes
Contact
NameDetails
Maria Luisa Badenes
First name:Maria
Last name:Badenes
Title:Professor
Institution:Valencian Institure for Agricultural Research
Address:Apartado Oficial, 46113 Moncada, Valencia, Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerPGS1.03.Forward primerPrunus armeniacaprimer
Reverse primerPGS1.03.Reverse primerPrunus armeniacaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGS1.03PGS1.03Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-LL-F2-Lito-2012LG1N/A0.9PGS1.03View
2Apricot-integrated-F1-Goldrich-2012LG1N/A0.6PGS1.03View