Gol061, Gol061 (genetic_marker) Prunus armeniaca

Marker Overview
NameGol061
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
PCR Condition59.73; 59.52
Primer 1Gol061.Forward Primer: TGGCTCAACCACAAAGTGAC
Primer 2Gol061.Reverse Primer: GGAGCTAGTCTTCTGTCCAAGG
Product Length275
Publication[view all]
ContactMaria Luisa Badenes
Maria Badenes
Contact
NameDetails
Maria Luisa Badenes
First name:Maria
Last name:Badenes
Title:Professor
Institution:Valencian Institure for Agricultural Research
Address:Apartado Oficial, 46113 Moncada, Valencia, Spain
Email:badenes_mlu@gva.es
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerGol061.Forward PrimerPrunus armeniacaprimer
Reverse PrimerGol061.Reverse PrimerPrunus armeniacaprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to plum pox virusqRPPV.integrated-Gol-LG1Prunus armeniacaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Gol061Gol061Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-LL-F2-Lito-2011LG1N/A20.9Gol061View
2Apricot-integrated-Goldrich-2011LG1N/A18.7Gol061View
3Apricot-LL-F2-Lito-2012LG1N/A0Gol061View
4Apricot-integrated-F1-Goldrich-2012LG1N/A0Gol061View