Gol029, Gol029 (genetic_marker) Prunus armeniaca

Marker Overview
NameGol029
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
PCR Condition59.30; 58.70
Primer 1Gol029.Forward Primer: GTGCAGCCCTAGATTAATAGCC
Primer 2Gol029.Reverse Primer: GCATCTCAGCAGCATTTCTC
Product Length286
Publication[view all]
ContactMaria Luisa Badenes
Maria Badenes
Contact
NameDetails
Maria Luisa Badenes
First name:Maria
Last name:Badenes
Title:Professor
Institution:Valencian Institure for Agricultural Research
Address:Apartado Oficial, 46113 Moncada, Valencia, Spain
Email:badenes_mlu@gva.es
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerGol029.Forward PrimerPrunus armeniacaprimer
Reverse PrimerGol029.Reverse PrimerPrunus armeniacaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Gol029Gol029Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-LL-F2-Lito-2011LG1N/A28.6Gol029View
2Apricot-integrated-Goldrich-2011LG1N/A25.3Gol029View
3Apricot-LL-F2-Lito-2012LG1N/A4.6Gol029View
4Apricot-integrated-F1-Goldrich-2012LG1N/A6.7Gol029View