96P10_SP6, 96P10_SP6 (genetic_marker) Prunus armeniaca

Marker Overview
Name96P10_SP6
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
Repeat Motif(TC)11N32(CT)11A(TC)6
Primer 196P10_SP6.Forward primer: acaaaacaagtccccattgc
Primer 296P10_SP6.Reverse primer: tgggtttgaaaatggagaaaa
Product Length163
Publication[view all]
ContactMaria Luisa Badenes
Contact
NameDetails
Maria Luisa Badenes
First name:Maria
Last name:Badenes
Title:Professor
Institution:Valencian Institure for Agricultural Research
Address:Apartado Oficial, 46113 Moncada, Valencia, Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primer96P10_SP6.Forward primerPrunus armeniacaprimer
Reverse primer96P10_SP6.Reverse primerPrunus armeniacaprimer


This genetic_marker is located in the following heritable_phenotypic_marker feature(s):

Feature NameUnique NameSpeciesType
resistance to plum pox virusresistance to plum pox virus-PPVresPrunus armeniacaheritable_phenotypic_marker


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
96P10_SP696P10_SP6Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-LL-F2-Lito-2012LG1N/A3.496P10_SP6View
2Apricot-integrated-F1-Goldrich-2012LG1N/A4.996P10_SP6View