NZsnCN943818, NZsnCN943818 (genetic_marker) Malus x domestica

Marker Overview
NameNZsnCN943818
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesMalus x domestica
Primer 1NZsnCN943818.Forward primer: CGGGAAGAGGAAATGTGATT
Primer 2NZsnCN943818.Reverse primer: TGAACAGCTCATCGTCGGTA
Publication[view all]
ContactS. Gardiner
Contact
NameDetails
S. Gardiner
First name:Sue
Last name:Gardiner
Institution:HortResearch, New Zealand
Address:HortResearch Palmerston North Tennent Drive Private Bag 11 030 Palmerston North, New Zealand
Email:sgardiner@hortresearch.co.nz
Phone:64-6-356 8080
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerNZsnCN943818.Forward primerMalus x domesticaprimer
Reverse primerNZsnCN943818.Reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NZsnCN943818NZsnCN943818Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M9xR5-F1-2008LG3N/A53NZsnCN943818View