EPPISF025, EPPISF025 (genetic_marker) Prunus persica

Marker Overview
NameEPPISF025
Genbank IDDN677202
TypeSSR
SpeciesPrunus persica
Repeat Motif(TC)7
PCR Condition57
Primer 1EPPISF025.Forward: TTGGCTTCCTCTTTCCTATCC
Primer 2EPPISF025.Reverse: AGTTTTTGGAGGCTGTGGTG
Max Length170
Publication[view all]
ContactIgnazio Verde
Contact
NameDetails
Ignazio Verde
First name:Ignazio
Last name:Verde
Title:researcher
Institution:Istituto Sperimentale per la Frutticoltura (CRA)
Address:Via di Fioranello 52, Ciampino Aeroporto, 00040 Rome, Italy
Country:Italy
Email:ignazio.verde@entecra.it
Phone:(+39) 0679348183
Fax:(+39) 0679341630
Keywords:Peach
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardEPPISF025.ForwardPrunus persicaprimer
ReverseEPPISF025.ReversePrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
EPPISF025EPPISF025Prunus persicamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-BN-F1LG1_BbN/A30.7EPPISF025View
2Peach-CA-BC1-2017LG1N/A44.2EPPISF025View