MEST120, MEST120 (genetic_marker) Malus x domestica

Marker Overview
NameMEST120
Genbank IDAB627265
TypeEST-SSR
SpeciesMalus x domestica
Repeat Motif(ag)11
Primer 1MEST120.Forward primer: agagagctgttttcgcttgg
Primer 2MEST120.Reverse primer: aatgctgaggcagtaatggg
Publication[view all]
ContactShigeki Moriya
Contact
NameDetails
Shigeki Moriya
First name:Shigeki
Last name:Moriya
Title:Researcher
Institution:Apple Research StationNARO Institute of Fruit Tree Science
Address:Apple Research Station, NARO Institute of Fruit Tree Science, Shimokuriyagawa, Morioka, Iwate 020-0123, Japan
Country:Japan
Email:moriyas@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerMEST120.Forward primerMalus x domesticaprimer
Reverse primerMEST120.Reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MEST120MEST120-24.7Malus x domesticamarker_locus
MEST120MEST120Malus x domesticamarker_locus
MEST120MEST120-19.7Malus x domesticamarker_locus
MEST120MEST120-78.75Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1J1N/A24.7MEST120View
2Pear-AN-F1LG1N/A29.4MEST120View
3Pear-Ba-F1-2013Ba1N/A19.7MEST120View
4Pear-integrated_consensus_map-IPCG-2017LG1N/A78.75MEST120View