SAmsCN444745, SAmsCN444745 (genetic_marker) Malus x domestica

Marker Overview
NameSAmsCN444745
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(ACAT) 7
Primer 1SAmsCN444745.Forward Primer: AGGAAATAAACACCGAGTAAAC
Primer 2SAmsCN444745.Reverse Primer: GATCAGTGAGAGTGTGATGC
Max Length180
Publication[view all]
ContactFelicidad Fernandez-Fernandez
Contact
NameDetails
Felicidad Fernandez-Fernandez
First name:Felicidad
Last name:Fernandez-Fernandez
Title:Researcher
Institution:East Malling Research
Address:East Malling Research (EMR), New Road, East Malling, Kent ME19 6BJ, UK
Country:United Kingdoms
Email:felicidad.fernandez@emr.ac.uk
Fax:+44 1732 849067
Last update:Mar 2006
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerSAmsCN444745.Forward PrimerMalus x domesticaprimer
Reverse PrimerSAmsCN444745.Reverse PrimerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SAmsCN444745SAmsCN444745Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F15N/A65.5SAmsCN444745View
2Apple-M432-2012LG5N/A66SAmsCN444745View