Hi21g05, Hi21g05 (genetic_marker) Malus x domestica

Marker Overview
NameHi21g05
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifAAG
PCR Conditionannealing temp 60 degree
Primer 1Hi21g05.primer 1: GACGAGCTCAAGAAGCGAAC
Primer 2Hi21g05.primer 2: GTTTGCTCTTGCCATTTTCTTTCG
Product Length155-164
PolymorphismP_ Hi21g05
Publication[view all]
ContactA. Patocchi
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi21g05.primer 1Malus x domesticaprimer
primer 2Hi21g05.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi21g05xHi21g05xMalus x domesticamarker_locus
Hi21g05yHi21g05yMalus x domesticamarker_locus
Hi21g05.xHi21g05.xMalus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006D1N/A7.8Hi21g05xView
2Apple Integrated map1N/A2.5Hi21g05xView
3Apple-FD-F1-2006F15N/A75.7Hi21g05yView
4Apple-MM-F11N/A1.3Hi21g05.xView
5Apple-M432-2012LG1N/A1.1Hi21g05.xView