Hi12c02, Hi12c02 (genetic_marker) Malus x domestica

Marker Overview
NameHi12c02
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifAAG
PCR Conditionannealing temp 60 degree
Primer 1Hi12c02.primer 1: GCAATGGCGTTCTAGGATTC
Primer 2Hi12c02.primer 2: GTTTCACCAACAGCTGGGACAAG
Product Length169-190
PolymorphismP_ Hi12c02
Publication[view all]
ContactA. Patocchi
Ana Wünsch
CommentJust need to add in aliases
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2011Characterization and mapping of non-S gametophytic self-compatibility in sweet cherry (Prunus avium L.). 2011. Journal of Experimental Botany. 62(6): 1847–1856.
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Ana Wünsch
First name:Ana
Last name:Wünsch
Title:researcher
Institution:CITA Aragon
Address:Avda. Montañana 930
Country:Spain
Email:awunsch@aragon.es
Phone:+34 976 713591
Keywords:cherry
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi12c02.primer 1Malus x domesticaprimer
primer 2Hi12c02.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi12c02Hi12c02Malus x domesticamarker_locus
Hi12c02dHi12c02dMalus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006F1N/A58.5Hi12c02View
2Apple-FD-F1-2006D1N/A42Hi12c02View
3Apple Integrated map1N/A62.6Hi12c02View
4Apple-GDxA-F1LG1AN/A36.7Hi12c02View
5Apple-GDxA-F1LG1BN/A36.9Hi12c02View
6Apple-GDxA-F1LG1CN/A36.5Hi12c02View
7Apple-GDxJ-F1-2012LG1N/A83.1Hi12c02View
8Apple-RGxPI6-F1LG1N/A63.1Hi12c02dView