CH03g12, CH03g12 (genetic_marker) Malus x domestica

Marker Overview
Genbank IDN/A
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH03g12.primer 1: GCGCTGAAAAAGGTCAGTTT
Primer 2CH03g12.primer 2: CAAGGATGCGCATGTATTTG
Product Length154-200
PolymorphismP_ CH03g12
Publication[view all]
ContactC. Gessler
Cindy F. Verdu
Fabrizio Costa
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2013Di Guardo M, Tadiello A, Farneti B, Lorenz G, Masuero D, Vrhovsek U, Costa G, Velasco R, Costa F. A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.). PloS one. 2013; 8(10):e78004.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
2014Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Fabrizio Costa
First name:Fabrizio
Last name:Costa
Institution:Research and Innovation Centre, Foundation Edmund Mach
Address:Via Mach 1, I-38010 San Michele all’Adige, Trento, Italy

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH03g12.primer 1Malus x domesticaprimer
primer 2CH03g12.primer 2Malus x domesticaprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH03g12CH03g12Malus x domesticamarker_locus
CH03g12zCH03g12zMalus x domesticamarker_locus
CH03g12yCH03g12yMalus x domesticamarker_locus
CH03g12-1_SCH03g12-1_SMalus x domesticamarker_locus
CH03g12.zCH03g12.zMalus x domesticamarker_locus
CH03g12.yCH03g12.yMalus x domesticamarker_locus
CH03g12CH03g12-14.8Malus x domesticamarker_locus
CH03g12CH03g12-53.5Malus x domesticamarker_locus
CH03G12_ACH03G12_AMalus x domesticamarker_locus
CH03G12_1CH03G12_1Malus x domesticamarker_locus
CH03G12_BCH03G12_BMalus x domesticamarker_locus
Ch03g12_MCh03g12_MMalus x domesticamarker_locus
CH03g12CH03g12-111.9Malus x domesticamarker_locus
CH03g12CH03g12-113.146Malus x domesticamarker_locus
CH03g12CH03g12-111.58Malus x domesticamarker_locus
CH03g12CH03g12-43.74Malus x domesticamarker_locus
CH03g12CH03g12-237.03Malus x domesticamarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
8Apple Integrated map1N/A1.5CH03g12zView
9Apple-IM-F1-Mr5Mr5 LG 1N/A22.5CH03g12zView
15Apple Integrated map3N/A89.1CH03g12yView
18Apple-IM-F1-IdaredIda LG 3N/A81.2CH03g12yView
19Apple-IM-F1-Mr5Mr5 LG 3N/A62.4CH03g12yView