CH-Vf1, CH-Vf1 (genetic_marker) Malus x domestica

Marker Overview
NameCH-Vf1
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifAG
PCR Conditionannealing temp 60 degree
Primer 1CH-Vf1.primer 1: ATCACCACCAGCAGCAAAG
Primer 2CH-Vf1.primer 2: CATACAAATCAAAGCACAACCC
Product Length129-174
Publication[view all]
ContactA. Patocchi
Publications
YearPublication
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH-Vf1.primer 1Malus x domesticaprimer
primer 2CH-Vf1.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following heritable_phenotypic_marker feature(s):

Feature NameUnique NameSpeciesType
apple scab resistanceApple scab resistance-Va1Malus x domesticaheritable_phenotypic_marker


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Venturia inaequalisqRVI.DT-ch1(T).4Malus x domesticaQTL
resistance to Venturia inaequalisqRVI.DT-ch1(T).1Malus x domesticaQTL
resistance to Venturia inaequalisqRVI.DT-ch1(T).2Malus x domesticaQTL
resistance to Venturia inaequalisqRVI.DT-ch1(T).3Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH-Vf1CH-Vf1Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-DT-F11N/A43CH-Vf1View
2Apple-C16xC17-F1-20121N/A53.49CH-Vf1View
3Apple-X3259X3263-F11N/A60.15CH-Vf1View
4Apple Integrated map1N/A65.5CH-Vf1View
5Apple-FD-F1-2006D1N/A55.9CH-Vf1View
6Apple-RGTxGD-F1-2015GD_1N/A50.34CH-Vf1View
7Pear-AP3480-F1P3480-LG1N/A53.6CH-Vf1View