CH05g08, CH05g08 (genetic_marker) Malus x domestica

Marker Overview
NameCH05g08
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH05g08.primer 1: CCAAGACCAAGGCAACATTT
Primer 2CH05g08.primer 2: CCCTTCACCTCATTCTCACC
Product Length161-179
PolymorphismP_ CH05g08
Publication[view all]
ContactC. Gessler
Andreas Peil
Miyuki Kunihisa
Ana Wünsch
Publications
YearPublication
2004Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2013Lê Van A, Caffier V, Lasserre-Zuber P, Chauveau A, Brunel D, Le Cam B, Durel CE. Differential selection pressures exerted by host resistance quantitative trait loci on a pathogen population: a case study in an apple × Venturia inaequalis pathosystem. The New phytologist. 2013 Feb; 197(3):899-908.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2011Characterization and mapping of non-S gametophytic self-compatibility in sweet cherry (Prunus avium L.). 2011. Journal of Experimental Botany. 62(6): 1847–1856.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Ana Wünsch
First name:Ana
Last name:Wünsch
Title:researcher
Institution:CITA Aragon
Address:Avda. Montañana 930
Country:Spain
Email:awunsch@aragon.es
Phone:+34 976 713591
Keywords:cherry
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH05g08.primer 1Malus x domesticaprimer
primer 2CH05g08.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
procyanidin B2 contentqPCB.X5210X8402-LG1.F09.2Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.F09.otherProcyanidin.1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.F09.otherProcyanidin.2Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J10.4CaffeoylquinicAcidMalus x domesticaQTL
p-coumaroyl quinic acid contentqCQA.X5210X8402-LG1.J10.4pMalus x domesticaQTL
p-coumaroyl quinic acid contentqCQA.X5210X8402-LG1.J10.5pMalus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.F08.phloridzinMalus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J10.phloridzinMalus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH05G08_DTCH05G08_DTMalus x domesticamarker_locus
CH05g08CH05g08Malus x domesticamarker_locus
CH05g08CH05g08-72.1Malus x domesticamarker_locus
CH05g08CH05g08-56.6Malus x domesticamarker_locus
CH05g08CH05g08-58.6Malus x domesticamarker_locus
CH05g08CH05g08-124.9Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-DT-F1-2013LG1N/A60CH05G08_DTView
2Apple-DT-F11N/A60CH05g08View
3Apple-FD-F1-2006D1N/A77.4CH05g08View
4Apple Integrated map1N/A86.8CH05g08View
5Pear-BH-F1Ba1-2N/A22.9CH05g08View
6Apple-FD-F1-2006F1N/A69.9CH05g08View
7Apple-IM-F1-IdaredIda LG 1N/A77.2CH05g08View
8Apple-PF-F1-2012ch1N/A75CH05g08View
9Apple-MM-F11N/A59.7CH05g08View
10Apple-OA-F1-AkaneAK1N/A64.1CH05g08View
11Apple-GDxA-F1LG1AN/A53.5CH05g08View
12Apple-GDxA-F1LG1BN/A53.3CH05g08View
13Apple-GDxA-F1LG1CN/A55.2CH05g08View
14Apple-X3259X3263-F11N/A68.14CH05g08View
15Apple-M432-2012LG1N/A65.7CH05g08View
16Apple-RGTxGD-F1-2015RGT_1N/A56.14CH05g08View
17Apple-X5210X8402-F1-ConsensusLG1N/A59.6CH05g08View
18Apple-X5210X8402-F1-X5210LG1N/A70CH05g08View
19Apple-X5210X8402-F1-X8402LG1N/A76.2CH05g08View
20Pear-BD-F1-2014-geneticLG1N/A92CH05g08View
21Pear-Bartlett-F1-2007Ba1N/A70.2CH05g08View
22Apple-FD-Discovery-F1-2003D1N/A77.3CH05g08View
23Apple-JM7xS63-F1J1N/A72.1CH05g08View
24Apple-JM7xS63-F1S1N/A56.6CH05g08View
25Pear-Ba-F1-2013Ba1N/A58.6CH05g08View
26Pear-integrated_consensus_map-IPCG-2017LG1N/A124.9CH05g08View