RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1, RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1
Aliasss475876651
rs267609598
c475876651
SNP_CT_154698_Lg1_00288_MAF50_285078_exon1
AX-105197239
dbSNP IDss475876651
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1
50K SNP array for apple:RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCATACTGGTTGAACTCGCAGCTTGGAACAAATATC
3' Flanking SequenceCTTGTAATTTAAAAATTTCGAGGGATATAAAGTTT
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_CT_154698_Lg1_00288_MAF50_285078_exon1RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1Malus x domesticamarker_locus
ss475876651ss475876651Malus x domesticamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Mdo-HB-01-1Mdo-HB-01-1Malus x domesticahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
2Mdo-HB-01-1_2Malus x domesticahaplotype
3Mdo-HB-01-1_3Malus x domesticahaplotype
4Mdo-HB-01-1_4Malus x domesticahaplotype
5Mdo-HB-01-1_5Malus x domesticahaplotype
6Mdo-HB-01-1_6Malus x domesticahaplotype
7Mdo-HB-01-1_7Malus x domesticahaplotype
8Mdo-HB-01-1_8Malus x domesticahaplotype
9Mdo-HB-01-1_9Malus x domesticahaplotype
10Mdo-HB-01-1_10Malus x domesticahaplotype
11Mdo-HB-01-1_11Malus x domesticahaplotype
12Mdo-HB-01-1_12Malus x domesticahaplotype
13Mdo-HB-01-1_13Malus x domesticahaplotype
14Mdo-HB-01-1_14Malus x domesticahaplotype
15Mdo-HB-01-1_15Malus x domesticahaplotype
16Mdo-HB-01-1_16Malus x domesticahaplotype
17Mdo-HB-01-1_17Malus x domesticahaplotype
18Mdo-HB-01-1_18Malus x domesticahaplotype
19Mdo-HB-01-1_19Malus x domesticahaplotype
20Mdo-HB-01-1_20Malus x domesticahaplotype
21Mdo-HB-01-1_21Malus x domesticahaplotype
22Mdo-HB-01-1_22Malus x domesticahaplotype
23Mdo-HB-01-1_23Malus x domesticahaplotype
24Mdo-HB-01-1_24Malus x domesticahaplotype
25Mdo-HB-01-1_25Malus x domesticahaplotype
26Mdo-HB-01-1_26Malus x domesticahaplotype
27Mdo-HB-01-1_27Malus x domesticahaplotype
28Mdo-HB-01-1_28Malus x domesticahaplotype
29Mdo-HB-01-1_29Malus x domesticahaplotype
30Mdo-HB-01-1_30Malus x domesticahaplotype
31Mdo-HB-01-1_31Malus x domesticahaplotype
32Mdo-HB-01-1_32Malus x domesticahaplotype
33Mdo-HB-01-1_33Malus x domesticahaplotype
34Mdo-HB-01-1_34Malus x domesticahaplotype
35Mdo-HB-01-1_35Malus x domesticahaplotype
36Mdo-HB-01-1_36Malus x domesticahaplotype
37Mdo-HB-01-1_37Malus x domesticahaplotype
38Mdo-HB-01-1_38Malus x domesticahaplotype
39Mdo-HB-01-1_39Malus x domesticahaplotype
40Mdo-HB-01-1_40Malus x domesticahaplotype
41Mdo-HB-01-1_41Malus x domesticahaplotype
42Mdo-HB-01-1_42Malus x domesticahaplotype
43Mdo-HB-01-1_43Malus x domesticahaplotype
44Mdo-HB-01-1_44Malus x domesticahaplotype
45Mdo-HB-01-1_45Malus x domesticahaplotype
46Mdo-HB-01-1_46Malus x domesticahaplotype
47Mdo-HB-01-1_47Malus x domesticahaplotype
48Mdo-HB-01-1_48Malus x domesticahaplotype
49Mdo-HB-01-1_49Malus x domesticahaplotype
50Mdo-HB-01-1_50Malus x domesticahaplotype
51Mdo-HB-01-1_51Malus x domesticahaplotype
52Mdo-HB-01-1_52Malus x domesticahaplotype
53Mdo-HB-01-1_53Malus x domesticahaplotype
54Mdo-HB-01-1_54Malus x domesticahaplotype
55Mdo-HB-01-1_55Malus x domesticahaplotype
56Mdo-HB-01-1_56Malus x domesticahaplotype
57Mdo-HB-01-1_57Malus x domesticahaplotype
58Mdo-HB-01-1_58Malus x domesticahaplotype
59Mdo-HB-01-1_59Malus x domesticahaplotype
60Mdo-HB-01-1_60Malus x domesticahaplotype
61Mdo-HB-01-1_61Malus x domesticahaplotype
62Mdo-HB-01-1_62Malus x domesticahaplotype
63Mdo-HB-01-1_63Malus x domesticahaplotype
64Mdo-HB-01-1_64Malus x domesticahaplotype
65Mdo-HB-01-1_65Malus x domesticahaplotype
66Mdo-HB-01-1_66Malus x domesticahaplotype
67Mdo-HB-01-1_67Malus x domesticahaplotype
68Mdo-HB-01-1_68Malus x domesticahaplotype
69Mdo-HB-01-1_69Malus x domesticahaplotype
70Mdo-HB-01-1_70Malus x domesticahaplotype
71Mdo-HB-01-1_71Malus x domesticahaplotype
72Mdo-HB-01-1_72Malus x domesticahaplotype
73Mdo-HB-01-1_73Malus x domesticahaplotype
74Mdo-HB-01-1_74Malus x domesticahaplotype
75Mdo-HB-01-1_75Malus x domesticahaplotype
76Mdo-HB-01-1_76Malus x domesticahaplotype
77Mdo-HB-01-1_77Malus x domesticahaplotype
78Mdo-HB-01-1_78Malus x domesticahaplotype
79Mdo-HB-01-1_79Malus x domesticahaplotype
80Mdo-HB-01-1_80Malus x domesticahaplotype
81Mdo-HB-01-1_81Malus x domesticahaplotype
82Mdo-HB-01-1_82Malus x domesticahaplotype
83Mdo-HB-01-1_83Malus x domesticahaplotype
84Mdo-HB-01-1_84Malus x domesticahaplotype
85Mdo-HB-01-1_85Malus x domesticahaplotype
86Mdo-HB-01-1_86Malus x domesticahaplotype
87Mdo-HB-01-1_87Malus x domesticahaplotype
88Mdo-HB-01-1_88Malus x domesticahaplotype
89Mdo-HB-01-1_89Malus x domesticahaplotype
90Mdo-HB-01-1_90Malus x domesticahaplotype
91Mdo-HB-01-1_91Malus x domesticahaplotype
92Mdo-HB-01-1_92Malus x domesticahaplotype
93Mdo-HB-01-1_93Malus x domesticahaplotype
94Mdo-HB-01-1_94Malus x domesticahaplotype
95Mdo-HB-01-1_95Malus x domesticahaplotype
96Mdo-HB-01-1_96Malus x domesticahaplotype
97Mdo-HB-01-1_97Malus x domesticahaplotype
98Mdo-HB-01-1_98Malus x domesticahaplotype
99Mdo-HB-01-1_99Malus x domesticahaplotype
100Mdo-HB-01-1_100Malus x domesticahaplotype
101Mdo-HB-01-1_101Malus x domesticahaplotype
102Mdo-HB-01-1_102Malus x domesticahaplotype
103Mdo-HB-01-1_103Malus x domesticahaplotype
104Mdo-HB-01-1_104Malus x domesticahaplotype
105Mdo-HB-01-1_105Malus x domesticahaplotype
106Mdo-HB-01-1_106Malus x domesticahaplotype
107Mdo-HB-01-1_107Malus x domesticahaplotype
108Mdo-HB-01-1_108Malus x domesticahaplotype
109Mdo-HB-01-1_109Malus x domesticahaplotype
110Mdo-HB-01-1_110Malus x domesticahaplotype
111Mdo-HB-01-1_111Malus x domesticahaplotype
112Mdo-HB-01-1_112Malus x domesticahaplotype
113Mdo-HB-01-1_113Malus x domesticahaplotype
114Mdo-HB-01-1_114Malus x domesticahaplotype
115Mdo-HB-01-1_115Malus x domesticahaplotype
116Mdo-HB-01-1_116Malus x domesticahaplotype
117Mdo-HB-01-1_117Malus x domesticahaplotype
118Mdo-HB-01-1_118Malus x domesticahaplotype
119Mdo-HB-01-1_119Malus x domesticahaplotype
120Mdo-HB-01-1_120Malus x domesticahaplotype
121Mdo-HB-01-1_121Malus x domesticahaplotype
122Mdo-HB-01-1_122Malus x domesticahaplotype
123Mdo-HB-01-1_123Malus x domesticahaplotype
124Mdo-HB-01-1_124Malus x domesticahaplotype
125Mdo-HB-01-1_125Malus x domesticahaplotype
126Mdo-HB-01-1_126Malus x domesticahaplotype
127Mdo-HB-01-1_127Malus x domesticahaplotype
128Mdo-HB-01-1_128Malus x domesticahaplotype
129Mdo-HB-01-1_129Malus x domesticahaplotype
130Mdo-HB-01-1_130Malus x domesticahaplotype
131Mdo-HB-01-1_131Malus x domesticahaplotype
132Mdo-HB-01-1_132Malus x domesticahaplotype
133Mdo-HB-01-1_133Malus x domesticahaplotype
134Mdo-HB-01-1_134Malus x domesticahaplotype
135Mdo-HB-01-1_135Malus x domesticahaplotype
136Mdo-HB-01-1_136Malus x domesticahaplotype
137Mdo-HB-01-1_137Malus x domesticahaplotype
138Mdo-HB-01-1_138Malus x domesticahaplotype
139Mdo-HB-01-1_139Malus x domesticahaplotype
140Mdo-HB-01-1_140Malus x domesticahaplotype
141Mdo-HB-01-1_141Malus x domesticahaplotype
142Mdo-HB-01-1_142Malus x domesticahaplotype
143Mdo-HB-01-1_143Malus x domesticahaplotype
144Mdo-HB-01-1_144Malus x domesticahaplotype
145Mdo-HB-01-1_145Malus x domesticahaplotype
146Mdo-HB-01-1_146Malus x domesticahaplotype
147Mdo-HB-01-1_147Malus x domesticahaplotype
148Mdo-HB-01-1_148Malus x domesticahaplotype
149Mdo-HB-01-1_149Malus x domesticahaplotype
150Mdo-HB-01-1_150Malus x domesticahaplotype
151Mdo-HB-01-1_151Malus x domesticahaplotype
152Mdo-HB-01-1_152Malus x domesticahaplotype
153Mdo-HB-01-1_153Malus x domesticahaplotype
154Mdo-HB-01-1_154Malus x domesticahaplotype
155Mdo-HB-01-1_155Malus x domesticahaplotype
156Mdo-HB-01-1_156Malus x domesticahaplotype
157Mdo-HB-01-1_157Malus x domesticahaplotype
158Mdo-HB-01-1_158Malus x domesticahaplotype
159Mdo-HB-01-1_159Malus x domesticahaplotype
160Mdo-HB-01-1_160Malus x domesticahaplotype
161Mdo-HB-01-1_161Malus x domesticahaplotype
162Mdo-HB-01-1_162Malus x domesticahaplotype
163Mdo-HB-01-1_163Malus x domesticahaplotype
164Mdo-HB-01-1_164Malus x domesticahaplotype
165Mdo-HB-01-1_165Malus x domesticahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1 ID=RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1|Name=RosBREEDSNP_SNP_CT_154698_Lg1_00288_MAF50_285078_exon1|organism=Malus x domestica|type=genetic_marker|length=71bp
CATACTGGTTGAACTCGCAGCTTGGAACAAATATCRCTTGTAATTTAAAA
ATTTCGAGGGATATAAAGTTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A57.6SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
2Apple_HC64_F11N/A50.99SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
3Apple_HCMO_F11N/A1.25SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
4Apple_HGMM_Consenus1N/A1.25SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
5Apple-M432-20131N/A8.81SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
6Apple-M432-2013-physical-Malus-domestica1N/A154698SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
7Apple-Honeycrisp_Consensus-F11N/A0SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
8Apple-RosBREED-3.9K-20191N/A0SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
9Apple-BB-F11N/A3.82SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
10Apple-NC-F11N/A0.17SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
11Apple-NCZFBB-consensus1N/A0SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
12Apple-ZF-F11N/A0.57SNP_CT_154698_Lg1_00288_MAF50_285078_exon1View
13apple-RosBREED-sweetness-2015LG1N/A0.1ss475876651View
Alignments
Feature NameTypeLocationAnalysis
MDC030484.9 contig MDC030484.9:8134..8134. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr01 chromosome Chr01:7584179..7584179. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:7584178..7584178. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation