GDsnp00288, GDsnp00288 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00288
Aliasss475882256
rs267615201
c475882256
AX-105217142
dbSNP IDss475882256
SNP Array ID
IRSC 9K SNP array for apple:GDsnp00288
50K SNP array for apple:GDsnp00288
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTTTAGTTGGAAACACAAATAAGAATTTGACCATGT
3' Flanking SequenceAGAGAATGTTCATTATGCTGTCAAAGAAAAG
SpeciesMalus x domestica
Publication[view all]
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2013Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp00288GDsnp00288Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp00288 ID=GDsnp00288|Name=GDsnp00288|organism=Malus x domestica|type=genetic_marker|length=67bp
TTTAGTTGGAAACACAAATAAGAATTTGACCATGTRAGAGAATGTTCATT
ATGCTGTCAAAGAAAAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map1N/A0GDsnp00288View
2Apple-M432-20131N/A2.35GDsnp00288View
3Apple-M432-2013-physical-Malus-domestica1N/A154686GDsnp00288View
4Apple-JG-F1LG1N/A0GDsnp00288View
5Apple-JGxWSH-F1LG1N/A1.8GDsnp00288View
6Apple-WSH-F1LG1N/A0.9GDsnp00288View
Alignments
Feature NameTypeLocationAnalysis
MDC030484.9 contig MDC030484.9:8446..8446. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr01 chromosome Chr01:7584440..7584540+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:7584495..7584495. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:7584490..7584490. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation