RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13, RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13
Aliasss475876634
rs267609581
c475876634
SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13
AX-105187703
dbSNP IDss475876634
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13
50K SNP array for apple:RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13
TypeSNP
SNP AllelesT/C
5' Flanking SequenceAGTTGCTTGCACTGCTTCTCGTCATCCACTATCTG
3' Flanking SequenceGCCGAGGCACTAAGTACACACGTGAATGTGAAAT
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13Malus x domesticamarker_locus
RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13-42.23Malus x domesticamarker_locus
RosBREED_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13RosBREED_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13 ID=RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13|Name=RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13|organism=Malus x domestica|type=genetic_marker|length=70bp
AGTTGCTTGCACTGCTTCTCGTCATCCACTATCTGYGCCGAGGCACTAAG
TACACACGTGAATGTGAAAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20131N/A7.56RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13View
2Apple-M432-2013-physical-Malus-domestica17N/A25284565RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13View
3Pear-PH-CG-2017LG17N/A42.23RosBREEDSNP_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13View
4Pear-PM-F1-PEAR317N/A61.36RosBREED_SNP_CT_25284565_Lg17_MDP0000194307_MAF20_MDP0000194307_exon13View
Alignments
Feature NameTypeLocationAnalysis
MDC009269.217 contig MDC009269.217:14162..14162. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr17 chromosome Chr17:32549810..32549810. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr17 chromosome Chr17:32549809..32549809. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation