rs159238552, rs159238552 (genetic_marker) Prunus persica

Marker Overview
Namers159238552
dbSNP IDss275384376
TypeSNP
SNP AllelesA/G
SpeciesPrunus persica
Publication[view all]
ContactPedro Martinez-Garcia
CommentTOP
Contact
NameDetails
Pedro Martinez-Garcia
First name:Pedro
Last name:Martinez-Garcia
Title:Researcher
Institution:University of California
Address:Department of Plant Sciences, University of California, One Shields Ave, Davis, CA 95616, USA
Country:China
Email:pjmartinezgarcia@ucdavis.edu
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
UC Davis 6K Prunus persica SNPs 2011-11-22
Sequence
>rs159238552 ID=rs159238552|Name=rs159238552|organism=Prunus persica|type=genetic_marker|length=125bp
TGTCTAATTGTCTGGTACTTTATCCACCAATATCACCATGCAAATCACTT
ACAATCATGA[G/A]AAAGGAGAAGCAGTAAAATACCTCCACCATTATTT
CTTAATCTGAAACCAATGTGGAAGA
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:41918421..41918421. Prunus persica Whole Genome v1.0 Assembly & Annotation