M3b (genetic_marker) Prunus persica

Marker Overview
NameM3b
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
GermplasmAkatsuki
Source TypecDNA
Repeat Motif(AG)13G(GA)6
Primer 1M3b.F primer: CGAGAAACTCTGCACAGAGA
Primer 2M3b.R primer: GTAGCCGATTCAAAGCCTCC
Product Length224
PolymorphismP_ M3b
Publication[view all]
ContactT. Yamamoto
Maria Badenes
Contact
NameDetails
T. Yamamoto
First name:Toshiya
Last name:Yamamoto
Title:researcher
Institution:National Institute of Fruit Tree Science, Japan
Address:National Institute of Fruit Tree Science Fujimoto 2-1, Tsukuba Ibaraki 305-8605, Japan
Email:toshiya@affrc.go.jp
Phone:81-29-838-6474,6491
Keywords:Pyrus pyrifolia
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerM3b.R primerPrunus persicaprimer
F primerM3b.F primerPrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
M03bM03bPrunus persicamarker_locus


Germplasm
Stock NameType
Akatsukicultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-LL-F2-Lito-2011LG1N/A77.5M03bView
2Apricot-integrated-Goldrich-2011LG1N/A70.7M03bView
3Prunus-TxE-peachV2.0LG1N/A57.2M03bView