CPSCT023, CPSCT023 (genetic_marker) Prunus salicina

Marker Overview
NameCPSCT023
Genbank IDAY426208
TypeSSR
SpeciesPrunus salicina
GermplasmSanta Rosa
Source Typegenomic DNA
Repeat Motif(CT)8
PCR Condition94 C 1 min, 94 C 30 sec, 46 C 30 sec, 72 C 30 sec. 35 cycles, 72 C 5min
Primer 1CPSCT023.F primer: CGGGTTGACTCAGTTCCTTC
Primer 2CPSCT023.Forward Primer: CGGGTTGACTCAGTTCCTTC
Primer 3CPSCT023.R primer: ATTTGAGCAGAAGCCCAGAA
Primer 4CPSCT023.Reverse Primer: ATTTGAGCAGAAGCCCAGAA
Product Length135
Publication[view all]
ContactP. Arus
Renate Horn
Maria Badenes
Contact
NameDetails
P. Arus
First name:Pere
Last name:Arus
Institution:IRTA
Address:Institut de Recerca I Tecnologia Agroalimentaries (IRTA), Departament de Genetica Vegetal, Carretera de Cabrils s/n, 08348 Cabrils, Spain
Email:pere.arus@irta.es
Renate Horn
First name:Renate
Last name:Horn
Institution:Institut fur Biowissenschaften, Pflanzengenetik, Universitat Rostock
Address:Albert-Einstein-Str. 3, 18051 Rostock, Germany
Country:Germany
Email:renate.horn@uni-rostock.de
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerCPSCT023.R primerPrunus salicinaprimer
F primerCPSCT023.F primerPrunus salicinaprimer
Forward PrimerCPSCT023.Forward PrimerPrunus salicinaprimer
Reverse PrimerCPSCT023.Reverse PrimerPrunus salicinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CPSCT023CPSCT023Prunus salicinamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Alignment of genetic markers to Prunus persics v2.02019-04-11
Germplasm
Stock NameType
Santa Rosacultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus Bin MapLG2N/A45.4CPSCT023View
2Prunus-TE-F2G2N/A45.4CPSCT023View
3Peach-KVB-F2LG2N/A80.2CPSCT023View
4Prunus-TxE-peachV2.0LG2N/A45.4CPSCT023View
Alignments
Feature NameTypeLocationAnalysis
scaffold_2 supercontig scaffold_2:25344283..25344849. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp02 chromosome Pp02:28941626..28942192+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)