BPPCT004 (genetic_marker) Prunus persica

Marker Overview
NameBPPCT004
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
GermplasmOHenry
Source TypeGenomic DNA
genomic
Repeat Motif(CT)22
PCR Condition94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1BPPCT004.F primer: CTGAGTGATCCATTTGCAGG
Primer 2BPPCT004.R primer: AGGGCATCTAGACCTCATTGTT
Product Length200
Publication[view all]
ContactE. Dirlewanger
Renate Horn
Contact
NameDetails
E. Dirlewanger
First name:Elisabeth
Last name:Dirlewanger
Institution:INRA
Address:Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:France
Email:dirlewan@bordeaux.inra.fr
Renate Horn
First name:Renate
Last name:Horn
Institution:Institut fur Biowissenschaften, Pflanzengenetik, Universitat Rostock
Address:Albert-Einstein-Str. 3, 18051 Rostock, Germany
Country:Germany
Email:renate.horn@uni-rostock.de
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerBPPCT004.R primerPrunus persicaprimer
F primerBPPCT004.F primerPrunus persicaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
chilling requirementqCR.PA-ch3Prunus armeniacaQTL
ripening timeqRPT.GM-ch2.1Prunus armeniacaQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Monilinia fructicolaqRMF.CxEL-LG2.2009.FL-ifPrunus persicaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BPPCT004BPPCT004Prunus persicamarker_locus
BPPCT004BPPCT004-29.07Prunus persicamarker_locus


Germplasm
Stock NameType
OHenrycultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus Bin MapLG2N/A20.2BPPCT004View
2Apricot-PA-F1G2N/A23.9BPPCT004View
3Apricot-GM-F1G2N/A29.9BPPCT004View
4Peach-AJ-F2-2005G2N/A37.9BPPCT004View
5Peach-AJ-F2G2N/A37.9BPPCT004View
6Peach-PF-BC1-2005G2N/A52.1BPPCT004View
7Prunus-TE-F2G2N/A20.2BPPCT004View
8Flowering Cherry-CYxE750-F1-CY2N/A45.9BPPCT004View
9Flowering Cherry-CYxE750-F1-E7502N/A6.8BPPCT004View
10Peach_CxEL_F1CxEL2N/A26.6BPPCT004View
11Peach_CxEL_F1-physical-Prunus-persicaV1.0CxEL2N/A14575730BPPCT004View
12Prunus-TE-F2-20152N/A17.8BPPCT004View
13Peach-DvsS-BC2LG2N/A19BPPCT004View
14Peach-KVB-F2LG2N/A24.2BPPCT004View
15Prunus-TE-BC1-T1EG2_T1EN/A10.1BPPCT004View
16Prunus-TxE-peachV2.0LG2N/A20.2BPPCT004View
17Sweet Cherry-PAxPN-94G2N/A41.4BPPCT004View
18Sweet Cherry-47G2N/A45BPPCT004View
19Peach_Consensus_map_20182N/A29.07BPPCT004View